It is my contention that Darwinian Evolution fails because it cannot provide an adequate answer to the question of origins.
Darwinism, Methodological Naturalism, and Philosophical Naturalism
A basic definition of Darwinian Evolution is, “descent with modification,”[1] which, on face value, is rather unremarkable and non-controversial; because, one could look at this phrase and state that organisms have changed in appearance, size, shape from one generation to the next (human progeny, while looking similar to their parents, do not look exactly the same). However, this is not necessarily what Darwin meant, nor is it as far as he took his grand idea. The conclusion of his work is summarized in the following phrase, “…today’s diverse life-forms arose by descent from a common ancestor and that natural selection is a mechanism by which species can change and even new species arise.”[2] In other words, it was Darwin’s goal, and the goal of his successors, to describe the origin(s) of all life on this planet in such a way as to ascribe physical, naturalistic processes as the source. Another way of putting this is this: life from non-life; which, on a summary level, sounds very similar to spontaneous generation.[3] The difference being that spontaneous generation states that whole complex organisms arise from a non-living source (rocks, mud, rotting meat, etc); while Darwinian evolution, at least when discussing origins, ascribes non-living sources for the genesis of a simple single-celled organism (of course, Darwinism says much more beyond this point).
Darwinists claim that the first cell(s) arose from a conglomerate of self-organizing molecules, approximately 3.8 – 4.5 million years ago, and were, likely, prokaryotic (lacking a nucleus and other organelles, except ribosomes, and possessed a circular, rather than linear, genomic structure).[4] Which means that the presupposed original cell was very simple in physiology; this also means that the genome for said cell would likely be very short and simple, as well. I claim that the genome of the supposed ancestral cell would be very simple, because, if this cell did arise by the supposed spontaneous self-organizing properties of molecules then it is highly unlikely that these mindless chemicals (of which molecules are) would have come together to form a genome anything close to complexity of that which is found within an Escherichia coli bacterium. A recent study was attempted by a small team of scientists in order to determine the smallest number of genes necessary for a living cell. The number was set at 250 genes.[5] Considering that there are usually hundreds of nucleotides in a single gene, it should be clear that even the simplest genome is still quite complex.
It is believed that these ancestral cells would have been confined to oceans, due to the effects of ultraviolet light on bacterial genomes. However, at some point in time, photosynthetic bacteria are believed to have evolved from non-photosynthetic bacteria. These bacteria, through photosynthetic processes would have begun to release oxygen (O2) into the primordial atmosphere.[6] Eventually, as Darwinists claim, enough oxygen would have accumulated in the atmosphere to lead to the formation of ozone (O3). Once enough ozone had formed then short-wave UV light would have been blocked, which would have allowed life to finally emerge from their protective pools of water and migrate to land and establish new life systems.[7]
My Argument against Darwinism from Genetics
In this section, I will discuss how proteins are made, which is significant, as proteins perform most of the functions within a cell. I will also explain how mutations affect this process. I will then reflect how this is significant when we consider some of the presumed conditions of the “primordial earth”, per Darwinists.
The Central Dogma of Molecular Genetics. The Central Dogma of Molecular Genetics is a basic overview of how proteins are produced in the cell. Proteins are produced in the cell to perform all cellular functions[9] and many structures within the cell are composed, at least in part, of proteins.[10] Put another way, if the DNA is the “king” of the cell, proteins are the “bricks in the castle” and every other person within the king’s kingdom who has a specific task or role to play. Without proteins, life would not be possible.
The Central Dogma, in summary, goes like this: DNA → Transcription (formation of mRNA, tRNA, and rRNA) → Ribosome → Translation (linking of amino acids to form a peptide) → peptides are linked together to form a polypeptide → protein.[11] Once the protein is formed, it performs the function that it was designed to perform then it breaks down into its constituent parts to be recycled by the cell.
The Function of Codons in Translation (Protein Synthesis). Proteins are not actually made from a molecule of DNA; they are formed from specific sequences of nucleotides from a messenger RNA (mRNA) molecule. RNA is very similar to DNA in its structure, but there are a few differences. Some of the differences include: DNA is double stranded, RNA is single stranded; DNA has four nitrogenous bases in its nucleotides: adenine (A), thymine (T), cytosine (C), and guanine (G); RNA also has four nitrogenous bases in its nucleotides, three of the four are identical to that which is in DNA, but thymine is replaced by uracil (U) in RNA.
The function of each protein, though, is dependent upon the shape of the protein; the shape of a protein is determined by hydrogen and disulfide bonding regions of each protein. These regions are determined by the sequence of amino acids that make-up each protein.[12] The sequence of each amino acid, within each protein, is determined by the sequence of codons on the mRNA. Codons are a set of three nucleotides (represented by capital letters) on an mRNA molecule, which, when they properly interact with transfer RNA (tRNA) at a ribosome (site of protein synthesis), will determine each successive amino acid in a protein.[13] The first codon that is “read”, during the process of translation, is the start codon; which is comprised, in this order, of adenine (A), uracil (U), and guanine (G).
The processes of transcription and translation operate like this:[14]
1. The cell recognizes the need for a particular protein.
2. RNA polymerase (a protein enzyme that was synthesized prior to this point) links onto a section of DNA that possesses all of the genes for the needed protein.
3. RNA polymerase synthesizes a strand of mRNA from the DNA; the mRNA detaches once it is fully elongated.
4. The mRNA travels to a ribosome (which is, itself, comprised of rRNA and is made in a similar fashion to mRNA), which is the site of protein synthesis.
5. The large and small subunits of the ribosome surround the mRNA strand, much like a hamburger is surrounded by its bun.
6. Transfer RNA (tRNA) molecules, which carry one amino acid per tRNA, meet with the mRNA at the ribosome.
7. Initiation of translation begins with a tRNA recognizes the start codon on the mRNA (AUG) and lays down the first amino acid.
8. Successive tRNA’s begin to lay down the rest of the amino acids which are linked together as each tRNA lays down its amino acid.
9. As the amino acids are linked together, they elongate forming a peptide chain, and, eventually, a polypeptide (at least 30 amino acids in length).
10. The elongation of the polypeptide will stop when the tRNA encounters one of the stop codons on the mRNA.
11. The polypeptide is reshaped, which gives it its function, and is now a functional protein.
The questions that must now be answered are: (1) how does the tRNA recognize which amino acid to lay down; (2) what prevents a tRNA to lay down an incorrect amino acid? The answer to these questions has to do with a concept called complementarity and a deeper understanding of codons. Complementarity describes the chemical affinity provided by the bonds between nitrogen bases.[15] It is via complementarity that enables us to accurately predict the nucleotide contents of a strand of mRNA given the section of DNA in which the RNA has been copied from. With RNA, complementarity operates like this: adenine will bind with uracil and cytosine will bind with guanine. So, if a codon (section of three nucleotides on an mRNA molecule) is comprised of AUG, the tRNA will have the complementary anticodon (anything that properly bonds with a codon) comprised of UAC – no other sequence of nucleotides is able to bind with this codon.
The rest of the answer to the two questions is related to the order of the nucleotides in each codon. There are 20 amino acids found in living organisms.[16] The codon dictionary, in the table below, explains how the tRNA is able to lay down the correct amino acid (amino acids in bold and their codons are non-bold)[17]. This table shows us that if the first codon after the start codon is AAA, then the complementary tRNA to that codon will lay down the amino acid lysine.
Alanine (ala) |
GCU, GCC, GCA, GCG |
Leucine (leu) |
UUA, UUG, CUU, CUC, CUA, CUG |
Arginine (arg) |
CGU, CGC, CGA, CGG, AGA, AGG |
Lysine (lys) |
AAA, AAG |
Asparagine (asn) |
AAU, AAC |
Methionine (met) |
AUG (start codon) |
Aspartic acid (asp) |
GAU, GAC |
Phenylalanine (phe) |
UUU, UUC |
Cysteine (cys) |
UGU, UGC |
Proline (pro) |
CCU, CCC, CCA, CCG |
Glutamine (gln) |
CAA, CAG |
Serine (ser) |
UCU, UCC, UCA, UCG, AGU, AGC |
Glutamic acid (glu) |
GAA, GAG |
Threonine (thr) |
ACU, ACC, ACA, ACG |
Glycine (gly) |
GGU, GGC, GGA, GGG |
Tryptophan (trp) |
UGG |
Histidine (his) |
CAU, CAC |
Tyrosine (tyr) |
UAU, UAC |
Isoleucine (ile) |
AUU, AUC, AUA |
Valine (val) |
GUU, GUC, GUA, GUG |
Start codon (met) |
AUG |
Stop codons |
UAA, UGA, UAG |
Mutations and their Affects on the Translation of Proteins. One of the most common and simplest of all mutations is a frameshift mutation. A frameshift mutation is not a single type of mutation; there are actually three types of frameshift mutations: loss of a single nucleotide (deletion mutation), addition of a single nucleotide (addition mutation), and the addition or deletion of two or more nucleotides. In each of these examples the entire frame of reading would be altered past the point of the mutation. Another example of a simple type of mutation is a point mutation, in which a single nucleotide is changed (an example would be if adenine changed into thymine). With point mutations, the frame of reading isn’t shifted, but the message contained on the RNA is still changed.[18] Here’s the affect that each type of mutation would have on the message, “THE CAT SAW THE DOG” (each word has three letters; codons also have three nucleotides, which are abbreviated with single letters):
Point mutation: “THE BAT SAW THE DOG” or “THE CAT SAW THE HOG”.
Frameshift deletion mutation: “(loss of C) THE ATS AWT HED OG”.
Frameshift insertion mutation: “(insertion of M) THE CMA TSA WTH EDO G”.
These are non-real examples of each mutation, but they show how each would affect the sense of a message. In each case, the mutations either changed the reading of the message (point mutation), in that a new sentence results; or, the message now makes no sense (frameshift mutations).
Now that I’ve introduced and explained the two most common types of mutations, I will now explain the impact that mutations have on protein synthesis (translation). If we imagine that the gene on a strand of DNA for a protein that is used by a very simple bacterium (perhaps the hypothetical original and ancestor bacterium of Darwinism) for the catalysis (breakdown) of sulfates (possible food source for ancient bacteria) is: TACCTTAGTCGCGGGTATGTAACT. The complementary mRNA strand would be: AUG|GAA|UCA|GCG|CCC|AUA|CAU|UGA. The peptide chain would be made of the following amino acids, in this order:
met-glu-ser-ala-pro-ile-his
This peptide chain would have its shaped changed based upon the order of the amino acids. After the shape is changed, the peptide chain becomes a functional protein and would be used to breakdown sulfates in the bacterium’s cell membrane. Let’s suppose that the gene for this protein only exists in one area of the bacterium’s DNA. If the bacterium is not exposed to any mutagenic agents, it should be able to synthesize the sulfate catalyzing protein as needed. The bacterium would be able to breakdown sulfates, which ensures a food source, which would ensure the survival of the species.
Let’s imagine that this bacterium is exposed to a mutagen for a brief period of time and only one section of its DNA is affected, but it’s the section of DNA that contains the gene for our sulfate catalyzing protein. This exposure would very well lead to a frameshift mutation, because this is the most common type of mutation. If the mutation is a deletion then the affect on the DNA, resulting mRNA, and protein might be this (the seventh nucleotide, adenine, was deleted):
Original gene: TACCTTAGTCGCGGGTATGTAACT
Mutated gene: TACCTTGTCGCGGGTATGTAACT
Original mRNA: AUG|GAA|UCA|GCG|CCC|AUA|CAU|UGA
Mutated mRNA: AUG|GAA|CAG|CGC|CCU|UAC|AUU|GA
Original protein: met-glu-ser-ala-pro-ile-his
Mutated protein: met-glu-gln–arg-pro-tyr–ile (changes in amino acids are in bold)
As is evident, even if only one nucleotide is deleted, the affects would be disastrous for our fictitional bacterium. Instead of breaking sulfates down, this protein, because of the changes in the amino acids that are laid down, will have a completely different function or no function at all. This means that the bacterium would not be able to use its only food source; in other words, it would die. The affects on this bacterium would be the same even if the mutation is an insertion of an extra nucleotide or if one of the nucleotides is replaced with a different nucleotide. Different amino acids would be laid down by the tRNA, the protein would be, either non-functional or, it would have a completely different function. In any case, the result for the bacterium would be the same – death.
Darwinian View of the Early Earthen Atmosphere. According to Darwinists, the early earthen atmosphere contained very little oxygen (O2). The general consensus among evolutionists is that the atmosphere was a mixture of various gases: nitrogen, methane, water vapor, hydrogen, ammonia, carbon monoxide, carbon dioxide, and hydrogen sulfide.[19] But, according to this view, the atmosphere didn’t stay the same. Some bacteria developed the ability to capture the sun’s energy and convert carbon dioxide into sugars as a food source (photosynthesis); this is supposed to have happened a mere 2.5 billion years ago. The by-product of this process is oxygen; which, after a billion years, would have built up enough in the atmosphere to allow for other, non-photosynthetic, organisms to begin inhabiting land areas. All of this extra atmospheric oxygen would have had another affect, the development of ozone (O3) in the upper atmosphere, which led to the formation of the ozone layer.[20]
This is a significant event, for it is the ozone layer the shields us from 97-99% of the sun’s harmful short-wave ultraviolet (UV) light. The affects of short wave UV light on living cells are disastrous; as it acts to mutate, during extremely small dosages and short term exposure, and to destroy nucleic acids (DNA, RNA). One scientist, during a time in which over-exposure to sunlight became a national issue in the US, exposed human cells to extremely low dosages of short wave UV light to observe and document the affects. The results were decisive. The cells were exposed to 40 Joules of shortwave UV light/minute. After 120 minutes, post-exposure, the level of RNA synthesis (transcription) dropped to the point that the cells were producing only 20% of the original quantity of RNA as they had pre-exposure to the UV light. This result doesn’t even speak of the mutational affects on the DNA and RNA of the cell. Protein synthesis (translation) also decreased; at 40 Joules of shortwave UV light/minute, the amount of protein produced dropped to nearly zero 30 minutes post-exposure. Protein levels were undetectable beyond 30 minutes, which means that proteins were not being produced beyond this time. In the conclusion of this study, it was noted that all of the cells that had been exposed to low dosages of shortwave UV light died, primarily, due to DNA damage (mutational effects of UV light).[21] Shortwave UV light is so effective at destroying nucleic acids and bacterial cells that it is used in microbiological and genetics labs around the country to sterilize their equipment and work spaces to prevent cross-contamination of native bacteria into their test cultures.
The Incompatibility of Life in the Darwinian View of the Supposed Early Earthen Atmosphere. As previously noted, the predominant view is that the early earthen atmosphere lacked an ozone layer; if this was the case, the entire surface of the planet would have been bombarded with 100% of the shortwave UV light that would have reached the planet. The effects that this would have had on any simple single-celled organisms inhabiting the planet would likely have been catastrophic – if they were even able to evolve from non-living chemicals in the first place.
Remember, the parts of a cell are mostly protein and are produced by the DNA synthesizing RNA which leads to the synthesis of proteins. If life evolved from non-living chemicals then the chain of likely events that led to such an evolution would likely be like this:
1.) Mindless chemicals randomly coalesce in just the right way, to form a simple DNA chain with enough genes to produce a protein for the other cell parts as well as all of the necessary cellular functions.
2.) The newly formed DNA would have to begin synthesizing RNA’s to carry out cell functions; but to do this, the cell requires a special protein (RNA polymerase) to attach to the DNA and synthesize the RNA. So, now the question becomes, where does this protein come from? Did it evolve, or was it, somehow, formed by the DNA (this is impossible according to the current scheme of how the cell operates)? However, let’s assume that the cell was able to synthesize the needed RNA molecules.
3.) The RNA molecules would have led to the synthesis of proteins.
4.) These proteins would have, for reasons unknown to me, self-organized into a cell membrane and cell wall, in order to protect the DNA.
5.) Thus, the formation of the first cell.
Here’s where the problems occur for the Darwinist. First, if shortwave UV light is damaging and destructive to the life of cells that are already fully formed and functional, what kind of effect should we postulate for 100% of all of the shortwave UV light that comes from the sun to the earth interacting with the above process? It would be very unlikely, considering what we know about shortwave UV light, that nucleic acids (DNA, RNA) could have self-organized given the supposed condition of the early earth, per Darwinism. It is likely that any small fragment of DNA that had self-organized would have been damaged beyond the point of functioning (remember, there would not have been an ozone layer during this time).
The Darwinists have, in recent times, attempted to counter this logical conclusion by stating that any organisms, which may have evolved from non-life, would have been protected by the shortwave UV light by inhabiting the oceans.[22] They claim that these first organisms gradually evolved the ability to photosynthesize, which would have led to the release of gaseous oxygen, which would have led to the ozone layer, which would have enabled life to inhabit dry land. However, even if it is true that any early organisms would be shielded from UV light in the ocean, they still would have not survived when they attempted to photosynthesize. One of the effects that water has on light is as a filter. Water filters out successive parts of the visible spectrum until you reach a certain depth and then no light is visible. I claim that for effective photosynthesis to have taken place, the newly photosynthetic bacteria would have had to come near to the surface of the water. This would have exposed them to massive dosages of shortwave UV light, which would have led to cell death prior to any effective rate(s) of photosynthesis being established. This would have prevented gaseous oxygen from being formed and released into the atmosphere; which would have prevented ozone gas from forming; which would have prevented the ozone layer from forming.
Let us assume though that this early cell was able to bypass the problem of shortwave UV light destroying the self-organizing DNA, either prior to or during its ability to photosynthesize. It is still quite likely that any cell living in these conditions would have become so mutated that the cell would not be able to produce any or many of the functional proteins that it had produced before (see the above section on mutations and their affects on the translation of proteins). This would still lead to cell death. Any mutations that the parent cell had developed would be passed on to their daughter cells – which only means that they would inherit the same problems with producing functional proteins. This, too, would lead to cell death.
To summarize this part of my apologetic against Darwinism, cellular life operates on the ability to produce functional proteins. Proteins are synthesized from RNA. RNA are synthesized from DNA. DNA and RNA are damaged and destroyed (mutated) by exposure to shortwave UV light. This would lead, either, to immediate cell death or to eventual cell death, due to the effects on not being able to produce all of the necessary functional proteins. In short, life on this planet is not possible under the Darwinian paradigm.
Conclusion: Darwinism (Methodological and Philosophical Naturalism)
I believe that I have displayed that the paradigm for the genesis of life, per methodological naturalism, via my argument from genetics, is false. and impossible. Therefore, methodological naturalism is a poor explanation for life and is likely false.
[1]William K. Purves, David Sadava, Gordon H. Orians, H. Craig Heller, Life: The Science of Biology, 6th ed. (Sunderland: Sinauer Associates, Inc, 2001), 2.
[2] Sylvia S. Mader, Biology, 7th ed. (New York: McGraw-Hill, 2001), 291.
[3] Refuted by Louis Pasteur in the 19th Century during his work on explaining how diseases occur and how to fight them (Germ Theory). He replaced the former prevalent theory of spontaneous generation with the notion that life comes from life.
[4] Purves, et. al., Life, 3.
[5]A.R. Mushegian and E.V. Koonin, Proc. National Academy of Science USA 93 (1996): 10268-10273.
[6]Purves, et. al., Life, 382.
[9]Jacquelyn G. Black, Microbiology: Principles and Explorations, 5th ed. (Danvers: John Wiley & Sons, Inc., 2002), 98-101 & 111-132.
[10]Black, Microbiology, 76.
[11]William S. Klug & Michael R. Cummings, Genetics: A Molecular Perspective (Upper Saddle River: Pearson Education, Inc., 2003), 20.
[12]Purves, et. al., Life, 38.
[13]Klug & Cummings, Genetics, 102 – 107.
[14]This is a basic summary, for more complete details see: Klug & Cummings, Genetics, chapter 5-6.
[15]Klug & Cummings, Genetics, 34.
[16]For a complete list, see: Klug & Cummings, Genetics, 144.
[18]Klug & Cummings, Genetics, 163-164.
[19]Kevin Zahule; et. al., “Earth’s Early Atmosphere.” Cold Spring Harbor Perspectives in Biology 2 (2010): 4-7.
[20]Purves, et. al., Life, 4.
[21]G. J. Kantor and D. R. Hull, “An Effect of Ultraviolet Light on RNA and Protein Synthesis in Nondividing Human Fibroblasts.” Biophysical Journal 27 (1979) 359-370.
[22]Purves, et. al, Life, 4.
[23]Ronald H. Nash, Faith & Reason: Searching for a Rational Faith (Grand Rapids: Zondervan, 1988), 52.
[24]Ronald H. Nash, Life’s Ultimate Questions: An Introduction to Philosophy (Grand Rapids: Zondervan, 1999), 194.
[25]This view, taken to its logical conclusion, faces the problem of the actual infinite regress. If everything within the universe is explainable with the universe then the universe must be infinite. But this is impossible and absurd. If the universe if infinite then time is as well, since the concept of time is a slave to the fact of the existence of the universe. If time is infinite then it would take an infinite amount of time to move from one day to the next. Thus, we would never arrive at today; which is why this view, that everything in existence can be explained by something within the universe, is absurd.
[26]C. S. Lewis, Miracles (New York: Macmillan, 1960), 6-7.
[27]It should be noted that Darwinian evolutionists use this process, and only this process, to derive their conclusions about the nature of this world; that, in their view, it is a closed system, entirely physical, free from interaction with God.
[28]Mader, Biology, 7th ed., 9-12.
[29]Nash, Life’s Ultimate Questions, 219.